EST 1824327 is a singleton


Sequence

>1824327 (1 EST) Length=420 CACGTCAAATAACTCAACGATGGACACGAATTTATCATCTTCTGCCGTGATGAAGCAATGAGCCTCCGTGTCTGAAATTT TCATTGCAGGCGATGAGATTGACTGGAAACACAAATCACTCCACTCTGACAGCACACCCCACACTGCTCCCTGGCAACTG CGTGCTTGCGGCAAGGTGTGATGAGACACAAATGGATCGCTGACACTGAGCATTCCACTTGCATGAGAACACGTTTATTA AATTGACTCTCTGAAATGTACCCTCTCCTCCCTCCTTTTCCTCCCTACCTTCCTTTGCCACCAAACGGCATGCATTCATT CCCATGCAATGATTACAAAAGCAATTCCATCATTATGCTGGCGAGAGGCGCTCTGTGACGAGAAGCTGATTGACTACAAA ACCAAGATCTGCAATGAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824327: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243273392565AI069590TENU2650T. cruzi epimastigote normalized cDNA Library


Date: 14:15:34 on Fri 19 Jan 118.