EST 1824334 is a singleton


Sequence

>1824334 (1 EST) Length=481 TATCCAGATGATATTGGTTGCTGGATGTTGTACTTTCTTAACTATGTACAAATGGAACCTGGCCAGGGTCTGTTTTTATC AGACAGTGAGCCGCACGCATACCTGTACGGGGATGGCGTGGAAATCATGGCAAACAGCGATAACGTTGTGCGTGCTGGCC TGACTCCAAAGTGGAAAGACGTTCCCACGTTGCTGGAGATGTTGCATTATAATACCAATGGCCTGGAGCGGGCAAAGTAT GAGCGTTATCGCGCTGCCGAGGGAGAAGCATGGGAGGTGCAATGCTATTCTCCGCCGCGTAGGTTTACCGAATTTTCCCT CTACCGCTTGGAACACGTTGCACAGAAGGCGAGCGAAACTTGTGTCAATCTTCCCAACATTGGACTGGGCTTCTGTTTGG GCGGTGAGGGCGTTGTGAATGGGACGCACGTGGCGGAAGGCGACTGCTTTGCCGTTCCACACGGTCCGTTGAAGTGCGAG G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824334: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243343392572AI069597TENU2658T. cruzi epimastigote normalized cDNA Library


Date: 9:32:17 on Thu 23 Nov 117.