EST 1824343 is a singleton


Sequence

>1824343 (1 EST) Length=155 TCTCTCTGCTCTCATGCCGCACGTGGCCGAAATATCGTTTAGGGCCATGCGCTGCTGATATCCTTCACTCTTTAACCCCC GCCCTTTTTTTTTTTTTATTTCATTTGTCGTCTTCTCTTCTTTTTCTCCTCCCATCCCCCCACCCACTTTTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824343: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243433392581AI069606TENU2667T. cruzi epimastigote normalized cDNA Library


Date: 0:10:3 on Sun 19 Nov 117.