EST 1824352 is a singleton


Sequence

>1824352 (1 EST) Length=396 TTTGAGGCCACTGCTGACGCGAACCCATTTGAACGATGGATGCGGACGAAAGTGGAGGATCCAACCGGCGTATCCGACCA TGAAACAACTAAACACAATGCAAGTTTTGTAGAGGACATGCCAATCGCCACACCCGTTAACGATGGGGACGTTGACGAAG AGAACTCGGACGAATATTCCGACGTTGTAGATGACGTTGGGATGCAGTTTTTTGGTGTGGTTCATCCGGACTTTTTGGAC ATTGCATAGTGGCATAGTTGCTTGCCTGTTTTTACCATTTTTTCCCCTCTTTTTTTTTTTGCTTCTTTAAAAAAAAAATT CTTGTTTCCGTTTATTGAGTCTGCGGCGTGACGATGTCGAGTGAGTTGCTACTGAAATTTGTAATATTCGATTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824352: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243523392590AI069615TENU2676T. cruzi epimastigote normalized cDNA Library


Date: 19:21:58 on Fri 24 Nov 117.