EST 1824353 is a singleton


Sequence

>1824353 (1 EST) Length=455 TCCAAATGCTTCCAGCGATCAATAGTGCAACCACATTCCATTCCACACGGGTGGAAAGGGGGAGGGTGATGCAGACGGAA GCGGGTCAATTCACCACCTACATGCCTGGTGAAACATAAACAACAAACAAACAAACAAACAAATCAATAAAAAAAAAAAA ACAAACAACAACAACAACGATTGGGTCCGCTCAAATCTCGCATTTTTATTTTTTATTGCTTTGAGTGGAAACATTGTTAT CTATCACGTATCATGAATGAGAAACGTTTGTTACTGAGGACAATCGCGAGCGTTTTATTATTTGTAAAACAATTGGGAAT TTATGTATTGAGGGATTTATTTATTTGTGTGTTGTGTGCCACAAACATACATGATCAAAGCCATAACGGCTTGCCAGGAT CAAGCGAACAAAATGGACAATTGTCCAAATAGCATCCTTGGCAAAAAAATTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824353: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243533392591AI069616TENU2677T. cruzi epimastigote normalized cDNA Library


Date: 2:36:45 on Fri 24 Nov 117.