EST 1824354 is a singleton


Sequence

>1824354 (1 EST) Length=324 CCAGCCAAAGGACTTGGAGCAGATGAGTGGACTGAGGTGGAAAGAAATTCAGAAGGAGAATGAAACTCTTCTTCAGCGTG TGGCAGCGATGCAGAAAGAAGACTCTTCCCTTAATGTACTTTTGGAAGATTCTCGGGCACGTTGTACTTCATTGGAGCGG GAACTCGCGAAGAGAGTGGGGGCTGTCCGTCGCCACATTGTGGGTGGCGCTGCTCTGACCGACACTATTCCAATTCGTAA TCTTCAGCGCATCCTGCACGACGTCCTTCAGGAGAACTTGGTTCTTGTAGCAAGGGTGAAGGAACTTGAGTCCAGGTAAC CCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824354: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243543392592AI069617TENU2618T. cruzi epimastigote normalized cDNA Library


Date: 14:56:57 on Wed 22 Nov 117.