EST 1824360 is a singleton


Sequence

>1824360 (1 EST) Length=219 GAGGCTCCACTGAGTGAGTAGCGCGAAGGTCAAAGATGCCATGAGGAAAGGGAAACGAGCATTGGGGGGTCGATGGATAG ATTTTGTAAAGAGAAACGAGAATTAAGATGGATAAAAATGTACCGAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAACAA GAACAAGAACCAAAAAAAAAAAAAAAAAAAAAGGAGAGGGTGAGAAGTGGGAGTAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824360: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243603392598AI069623TENU2624T. cruzi epimastigote normalized cDNA Library


Date: 6:44:10 on Sat 25 Nov 117.