EST 1824363 is a singleton


Sequence

>1824363 (1 EST) Length=514 CAGAGGCGGAGGTGCTTCTGTCACAGTCGCCACAGAAGTTAAATAAAGATGAGCCGTTTCATGTGCCCTGTGAAAATGCC TCGTGGTGGGACTTCTCCATCAATCTCGGCACACACGGCGCGAGACTGCGGCTGCGGTGGACCCCAATGCGTGTCCTTAC GCTCGCTCTCGAAGAGGAGCAGAGAGCGAACGTGAACTGTTACCTGCGTCGCTGCGGTGCCCACGTCGTGACCGATTATT ACCGAGCGGACTATTTTGTTACCTCACTTCTTACGCCTACCCCTGTTACCATTGCCATGTTGTGTCGCGCCGTGGACATC GTGACGCCTGCCTTCTTTGAGGCACTGCGGAATCGCCAGGGACCGCACGTGCCGCTGCCGGACCCGCGGGTGTACACGCC GCCACTTGCGGATTTTTGGTCAAAACTGTGGGATGATGGGACAGAAGACAAGAGTGTTGGTGGCACCCACCCACAGGTGC AGTCAGTCGTGGATGATTCGGAAGGGCTGCGGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824363: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243633392601AI069626TENU2627T. cruzi epimastigote normalized cDNA Library


Date: 4:35:1 on Wed 22 Nov 117.