EST 1824364 is a singleton


Sequence

>1824364 (1 EST) Length=555 ATTTCAGGTGAACGCAGCCGATGGAAAGCCGTATGATCTCTCGCAGCACAAGGGACATCCACTGCTGATCTACAATGTGG CGAGTAGGTGTGGCTACACGAAGGGTGGCTACGAGACGGCCACGACGCTCTACAACAAGTACAAGGGCCAGGGCTTTACT GTTCTGGCGTTCCCGTGTAACCAATTTGCCGGGCAGGAGCCGGGGACGCGCTGGAGGTGAAGGAATTTGCCTGCACGCGG TTTAAGGCGGACTTCCCCATCATGGCAAAGATTGACGTGAATGGCAGCAAGGCACATCCGCTGTATGAGTTTATGAAGGC AACAATTCCCGGTCTTTTTGGCACTAAAGCCATCAAGTGGAACTTTACTTCGTTCCTTATTGACAGGCATGGTGTTCCCG TGGAGCGTTTTTCGCCTGGTGCATCTGTGGAAGATATTGAGAAAAAACTTTTGCCGCTTCTTGGTGGTGCTAGGATTTGA GTGGGGTAACTATTTCTTCGGGAAGAGGACGAGGGTGATGGAAGGGTGTGTGCGTGTATGAGGATGGGGGCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824364: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243643392602AI069627TENU2628T. cruzi epimastigote normalized cDNA Library


Date: 2:24:6 on Wed 22 Nov 117.