EST 1824372 is a singleton


Sequence

>1824372 (1 EST) Length=254 TTGCGACACATTTGGTAATATGGCCTTCAAGAGGCAACTGGAGTGCGTGACAAGGACAGTGATGTCAGCAGCGTCTGTCA GCAGAAGTTTGAGGAATTTGGAAGCCCTCATCCTCGATGAACATGAGGCTCGTCGAAACGTCGAGATGGACGTAGACGAG CTTAAAGATATTCAACAGAGAGGCACGCATGAGGATTACAGGTTGGACTACTTTAATGAAATGAAAAGGAAGGAGGCGTC GGCGGCGTCGGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824372: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243723392610AI069635TENU2678T. cruzi epimastigote normalized cDNA Library


Date: 13:8:45 on Sun 19 Nov 117.