EST 1824374 is a singleton


Sequence

>1824374 (1 EST) Length=529 CTATATTGTATAGTAGGGTAGGGAAAAATAAAGACGGGGAATCGGTGCATCAGAAAAGCCGGATAGGGACGTATGCTTCG TCGAACTACTGTTGTGAGAGGCCATGCTACCTCAAACCTTTTTGCTCCACCGTTTTCCGGTCGCTGGTTTAATCCTCCTC ACCAATGGACAATGACAGATACTTTTATGCCGTTTTTCTTTATTGGTTCGGCTCCTATGGCGATTTGTGTTTACCTTTAT CATGCAGCGTACATGCCGCATTACTCTCACTACCAAGATCAAAACTACTATGCCTCCCAAGTGTACACAAAAGAATTTAT TCACAAGTACAAACGATTAGAGCGTTGGAGATGGTACTAGGGAGTGAACGGGGCACTTTTTTATATATATTTGTATATGC ATGCTCTCCTGTGAGTATGGATGCATGTCGGGGCTGGGTGGGATTATATTTACGGTAGTGACTTTAAAGAAATGGCTGAT TTGATTTTGAACCGAAAGACGGAGGAAGTACGCCGTATTGAACAAGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824374: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243743392612AI069637TENU2680T. cruzi epimastigote normalized cDNA Library


Date: 22:24:28 on Tue 21 Nov 117.