EST 1824375 is a singleton


Sequence

>1824375 (1 EST) Length=524 CCAAAAGGCACTTGATCTTCTCAATGGCGCCGTCGTCGCTCTCTCTACGAGCTCAGAGCAGGGCGAGAACATGGCCAATT GCATCCGGGCCCTGTTGCTGCTGGACAGTTATAACGACAAGTCCTCGCCCGCCGGAACCGTGCCTCAGAGGCGAGCCGGA TTCTTGACAAGGTAGAGAGCTTCATCCACTCCAAGCAGATGCACGAGGTGGAGCCCGTTTTAGCCGCACTGCATTGCCAG GCCCGTGGAAAGGACTACGAGATACGCCAGCAGTACACAAAATACTACTCGAACGCTTTTGAAACCGTGAAGAGTGCGGA CGTGCCGAGATGCCGATTATTGAGAGTGACCTCTTGTCTCTTGCCTACAAAGCTGCTCTTTCGGCGCTCCTTTCGGAGGA AATTTATAACTTTGGTAAGTTTCTGAACGAACGTCACTTCACGGAGCGCCTTGCGGATTCTGTGCAACACGCGTGGATAC TCGAATGGCTGCGTCTCTGCAATGATGGCAAGGTGGAGGAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824375: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243753392613AI069638TENU2681T. cruzi epimastigote normalized cDNA Library


Date: 19:45:22 on Fri 17 Nov 117.