EST 1824386 is a singleton


Sequence

>1824386 (1 EST) Length=336 GCTGCAGTCCGTTCCCTTTGTGCATTGCCTCTGCTCGCAGACGTGCAAGCAGCACTTAGAGGTCCGTTTAGCGGAGTACG ACGCGTTACATTCTTCTGTGAAGCCGTCGTCGCCTTCGTCGTAAACGCCTCGCAAAGGTGCGACGCCCTTTTATGATGTA AGTGAGCCCAGCATTGTCCTCGCTTCCCTCCCCGGTATCATGTAGGTAGTCTTGCTTACTTCCCCTCGCACCGCATTTAC CGTGGTCGGGTAAAAAGAACAGTGGGAAGGAAGGAAGGAAAGAAAAGGAAGAAGAAGAAAAAAAAAAAGAAAAAGAACGG CAGGATGGGGATGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824386: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243863392624AI069649TENU2693T. cruzi epimastigote normalized cDNA Library


Date: 13:52:6 on Mon 20 Nov 117.