EST 1824392 is a singleton


Sequence

>1824392 (1 EST) Length=211 AATATTTTAAAAGTGGATCATTTGTCCCATCACCATTCTCATGGCCACGGATGTTGTGATCATAGCAATCATTTTCACGA CTCCGCCGGAGAAAGACATGAAGGGGGGGAACGAGACGGACACGAACGGGGTACAGAGAAAAGAAGGGAACATGATTATT TTTTTCCGGCTTTAGGGTCTGCTTCTTCATCTTCCATTTATTTTCCATCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824392: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243923392630AI069655TENU2699T. cruzi epimastigote normalized cDNA Library


Date: 6:35:4 on Thu 23 Nov 117.