EST 1824396 is a singleton


Sequence

>1824396 (1 EST) Length=391 AACTGAAGATGGACTATGAGCGCAAAAATGACGATGGATGCAAGAAGCTTTTGGAGAGCATCAAGAAAAAACTTATTCTG CTGCCAACGTTTCTCAACCCCACAGCACATAGCCGGACACGATCGGAGGAGTTAACACTCACCCGTGAGGTGCTGGAGCA CGGCGTGTTGGTCAGTGCGCGCCTCGGGGACCTTGATAGCTTTGAGCTCTATTTTAACCAACTCAATGTGTACTACACGG ATATTGATAGCAGTGAGCTTCCTGAATCCCCGTTGTACCTGCTCATCCTTGGACTCAATTTGGTTCGTCTGCTGGTCCGC AATCGCATTGCGCAATTTCACTCCGAGCTGGAGAAAATACCCAACCAAATTCACGGCACGAACACTTACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824396: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243963392634AI069659TENU2703T. cruzi epimastigote normalized cDNA Library


Date: 16:26:4 on Mon 20 Nov 117.