EST 1824404 is a singleton


Sequence

>1824404 (1 EST) Length=373 TGCCGAAAAAAAACAAGAAAAAAAGGCACCCAATAATAACGTCAGCAACAAAACATTTTTATTTTTACTTCTCCACACAC AAACACGCACGCACGCACACACAAATTCTTCCATATTTTTGTTCCTTTTATCGCTTTTCCACTCCGTTGATTTGACTTTC ATTTGGCTTCTGCTCTTCTCATTAATGTTAATGCTGTTTCCTTTTGGCAAATCCGTATTCCCCCGTTAGCAAAATAAATC CATAGATCTATTGAGCTATTTATTTATATCTCTTCTCCCCAATACACAGTCCTTAACGGGCTTCACGCACCCCCCTCCCA CCACCCCCGCCATCTCGCGCCCAAAGGAAAGAAGCCGTCAGTAAAAAGGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824404: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244043392642AI069667TENU2711T. cruzi epimastigote normalized cDNA Library


Date: 20:56:39 on Wed 22 Nov 117.