EST 1824405 is a singleton


Sequence

>1824405 (1 EST) Length=233 GTGAATCCGCCGCGCCGTTGTTTGCCCGGGGCGTCCCTTCACGCTCAGCCCCTCTTATGAGTGGGCGAGCTTCCAGCATG CGGGCGCCTTTACCATCGGCAAAAGCCAATGAGAGGACATCGGGGACACGAGTAGGAGGAGAAGGAACTGCACATGAGGG GAAACATGACAGCTTTCCCGAGCGGAATGCCGGTCTTGTGTCCGTTCCGTCCGCCGCACGGAAGGCTGATGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824405: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244053392643AI069668TENU2712T. cruzi epimastigote normalized cDNA Library


Date: 20:39:9 on Tue 21 Nov 117.