EST 1824410 is a singleton


Sequence

>1824410 (1 EST) Length=493 GGCAGAAGTAAACGGGGTGAGACGGCGACTGATAGCGTCACAGGGTGAAAGGGCAGTACTCTCTGTGGAATGCAATGCCG CGGGGGGAACAGCACCGGGAGCGGAGGGCTGAAGGGGTCTTTCCTACCACTCGGAGCCTATCGCCGTGTTCCTCGTGAAG CCACAAGTCTTTGGAAGACTACGATGGACACTGCTAAGGAGCAAGTTGCTGTTGTCTGGGAAACTGTTTCGTCATGGGAA GGAAGTGAAGTGACGAGCAGTGACTCATGTGCTTCAGGCATTAATGATCCTTCTCTAGAAGACGTGGGCTTGTGGGAAGA ACATCTCCAAATCCGCATGGAACTTATACGGCGGTTGAACCCTTTCCGTCAAGGTCCCCCTGTCGGTGGCGCGGCGCATA TGACGGCTTCAGCGGACGAAACGGAATGACGGGTACAAAATTGGGAAGTATTCGGACTCAACGGGCATGTGGCTCCGTTA CTTATGGAGAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824410: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244103392648AI069673TENU2717T. cruzi epimastigote normalized cDNA Library


Date: 16:58:17 on Wed 22 Nov 117.