EST 1824416 is a singleton


Sequence

>1824416 (1 EST) Length=494 TAAATAAATAAATAAACAAATAAATGTATTTGTGGTGGATTCCTTTATCCCTCGTTCGGTATCGGTTCCCCCTCACATCT CCTTCAGAACGCATAAACGACCGCGTCATAACCCATATATATATATGTATATATGGTTATTTTACTTTATTTTTTTGTTT GTTTGTTTGTTTCTCTTCTCTTTTACTGTGGTTTTTCTTCATTTTTTTTAAACACTCAACCGCCCCTCCCCGCCTTCCTT TCCATCGCCACGCATCACTCGACGAATGGAGTAGAGATGGGCGGGGCAAAAGAACGACAATCATCCACCCACCCAATTTG TCTCTCTCCCGCTCTCTCTCTCTCTTTGTGTGTGTGTGTGCTCTGGATGTCCAAACTCACTTGCCCCGCAAATGCGGCAA CGGAAGGATGTGGTTGCGTGGAGGCGCCAATGCCACTTGAATCAAACCGTGCCTGTGGACACACGCAAACAGGAAAGCGA TAGGAAGGAATAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824416: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244163392654AI069679TENU2723T. cruzi epimastigote normalized cDNA Library


Date: 21:47:26 on Mon 20 Nov 117.