EST 1824432 is a singleton


Sequence

>1824432 (1 EST) Length=462 CTGAGGAGCCATCCCATACTTTGAATGCTCTGACATCCCTTTCCACACGCCTCAATTCTTCGGTCAATGTTTCTCCGGAG CGAATGACTTGCAGAAGGCCTATAAGAGAAGCCAGCAGACCGTGTTGGAGTTGCTGGCAGTGAATAAAAAAATGAAGACA GAATCCGAGAAGGCCCGTGAGTTCATTGGAATTTTGCGGCAGAGGGTGAGGTCGCTAGAAGCCACTGTCGAGAAACTTGA ACTGAGGCAGTTGGCGGTGCTGATATTCCAGTGTGCGCTACAGAGCAGGATGTTGTCGTGGTGAATCTCAAGGAGGATCT ACTGAAGGTGGGAAGCCGTCTTCTTGAGGCTGATGCGGAGTCAACGCGGCTTAAGCGTGAGATAAGGGATTTAAGAAGTC TTCTTTCTCTTTACATGTCTAACACGAAGAAGTTGTAAGGGGGTCATTTTCCTCCTCCCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824432: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244323392670AI069695TENU2739T. cruzi epimastigote normalized cDNA Library


Date: 16:22:46 on Sun 19 Nov 117.