EST 1824436 is a singleton


Sequence

>1824436 (1 EST) Length=497 AATGATGCGGCCGAAACCTCCAGCCCACTGCTGGTGCTTCTGGCTTGACTGCTGCACCGCCCCCAGCAGCGGGTGTAGTG GGTCTGGGGATGACAACACAGTGGACGAAGTTCACTCGAATGGTGCTGGCGGCCCCGTCAACGTCTCGTCGACCCCAGCG ACCTACCCACACCACCGGCGAGCACAGACATGGACGAGACAGGGAAGGCATCAACAGACTGCCAGGGAAACAATTGCTTT TTCACATTACTTTCAGCAAACAACCGGAAGAATTCACAAAAACATCAATCACCAACAATGAAAAAGGAACAGCGACCACC GCGGCCAACAACGGCAGCACCGCAGGCCTCCACAAAAATTCCCCTCTTTTGCTTCTTCTTGTCACGTATGCAGCAACAGC TGCGTTGGTGGCTACGCTCGCATGAATTGGCGTGTGCTGGAGAGAGACGGCCAGAGGAAACCAGCTTCTCCTTGTGATGA ATATTGGCTGCACTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1824436: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244363392674AI069699TENU2743T. cruzi epimastigote normalized cDNA Library


Date: 21:22:56 on Fri 24 Nov 117.