EST 1824440 is a singleton


Sequence

>1824440 (1 EST) Length=506 CATAGTAACGCTAGGATGTGGCGGCAGTCGTTTCTGCGACTGTGCAAGGGTGCGACGGCAACGGCGACCGGTAGCAATGG TGGTGGGCGTTGTGTGACGGAGGAGCTCGAAGGGAGAACGAACAACATCTTTTCCATCCGCAGAGCCCCGAATAGTTTGT ACGAGGACAAAATGCACAGCAACAGCCTCACCGACCACCCGCTGACGCACCGAACGAGTCGCGACGAACTCGCGTACCGG AAACGGAAGCTGACGGAGAGGGGAAACTATGAACAGGCCGCCAAGGCGAAGAGGAGGCGGAACGTCGCGACACCGAAGCC GTGCAGGAGCTGAGACACGGGAATATTATAGCGCCATCTGTTTTGTGGTGCTTGGTTACTTGACTGCACATGGCGTTGTG TTCAAGCGGTTTTACCCTGACGATCTCCGGCCGTATTACTCCCCGGATCGCGGTTACTCGGACGACGTTGCGGCACGACG TCAAGACCTCGAGGCAGTCGATGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824440: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244403392678AI069703TENU2747T. cruzi epimastigote normalized cDNA Library


Date: 16:29:12 on Fri 17 Nov 117.