EST 1824450 is a singleton


Sequence

>1824450 (1 EST) Length=246 GGCTGAGAGAAAAAAAAAAAAAAAAAGAAGGTCCACTCCTATTTTTCTTTTTTTTGTTTCTTTTCTCGGAAGACGTCGCT TCACCCACCCTCTGCACACACACACGAGCACAGGGAAGGATGTGTTGTGCCCTGTTGGCTAACGAGATGGCGGGGAAGCC ACGACGTGCGCGAGAATAGAAAAGAGTGTTCCCAATTATTTTCTTTTATATCTTCTTTTTATAAAATGGTTTTCGACACA AAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824450: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244503392688AI069713TENU2757T. cruzi epimastigote normalized cDNA Library


Date: 23:41:15 on Fri 17 Nov 117.