EST 1824457 is a singleton


Sequence

>1824457 (1 EST) Length=438 CGTCAATGGAGCTGCTTACCAGCCAGCTGAGCTCGCTGTCCGACTCCATGCTGCAGGACATTGTGTCGAACCCCAACTGT CTGGAGTCCTACGCCTATCAGTTGCCGTTTTTTAAGGCCATTCGTGACGCCAGTTGCCAGACGATTGACGACATTGAGCG CGTACGAAACGAGAACTTGAAGTTGCAGCCGGTCGTGGAGAATTTGCGAGCCGAAGTGGAGGGGCTTCAACGTTCCCTCG AACAGAACGTGCAGTCCATGCAGAAGATGCTGCGAGCAACGCCGCTGTTGAATTCCATCGGCACCCCTGAGAGTCTGGCG AAAACGTTGGCGACTGATGTGAGGACGTTAGATGCACAATGCGAGGAAATTGCAAAGAAGATACTACAGTTGGACTGTGC CACAGACAAGCTCCGCTTTGACAATCTCCTGGAGGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824457: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244573392695AI069720TENU2764T. cruzi epimastigote normalized cDNA Library


Date: 16:19:0 on Sat 18 Nov 117.