EST 1824467 is a singleton


Sequence

>1824467 (1 EST) Length=433 TAGCGATCGAGTTGTGTGAGAGTGAGGCATTGAGTCGAATTGCAGGCGTTTAGCAAAAAAAAAAGAAAAAAAAAAAATAG ATGTCGTTCCTATTTCCGTTTCAACCGAGCGCGGATTTGGAGCGTGTTGCTGAAAACGTAGGAGGGGATGCGGCTGTTCT TGCTGCCCTTCTTTTTAACACCTCGACGCTTGGCACGTACCGCATCCAGGAGCATTCCATTCATCGGGTGAAGGATGCGA TTGAGCAAGGAAAGGGAATTGGGCAATTAAACTCGGAGAAGTATCGTCTTCTTTTGCAGGATGTAAAGTTGGCCGCTCAA CAGTTGCATGAAACAGTCGAGGAAGGAAGACATGCACTGCAGAGAATGCATTTATGTGTTGGGCGACTTCTCGTGGGCAT GCCGGGGACGGAGAGAAAGCAATTTCTCGGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824467: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244673392705AI069730TENU2774T. cruzi epimastigote normalized cDNA Library


Date: 11:41:41 on Wed 22 Nov 117.