EST 1824472 is a singleton


Sequence

>1824472 (1 EST) Length=435 TCAAAGTGACTGACGGTGCTCCAAGGACGACGAATTCCAAAGCTGTTTTTCCTCGCCCATTGTTCGAAGATTTTTCCTCT GCAAGGGAATCGTGCCACACGAACAAGTGTTGTGATTATAGTGACGGACCACATTGTTATAGCACAGGGCCATCGGGTAA AGTTAATTCTGCACGTAGCCGCGTCCCGGGAATATCCTCAACGCGTCTTAAGGCTAAGCCGCGCAACCTAACAGCGTCTC CCGTGCAACAAAAGAGCTTTTGGATTAATGTCTGGCCTTGTTTTGGCACCTTCACATCGTTTGTGTGCAAGCCGACAAGA ATCTTGGTGCACAGTAGTTACTGCTATATGGTGCATGTAACGGAGAAGGCGGGCACGCTGATGGGCTGCCGACCAGCGCC TAGTGTTCTTTACGAGCCTGACGGTCGTTCAGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824472: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244723392710AI069735TENU2779T. cruzi epimastigote normalized cDNA Library


Date: 14:6:5 on Mon 20 Nov 117.