EST 1824474 is a singleton


Sequence

>1824474 (1 EST) Length=310 GGGGTTCATCTCAGAAGGAATTCACGTGTTTTTTTTTTATTATTATTTCCCACCCCACCCCACCCCACTCCCTCTTCGCG GTGGCGGGGGTGTTCTTTTGGCTGCAGGATCCTACAGCCCGCCAATTGGTAAGGAATAAATAAATAAATAAATATATCCG ATCTTAACGTTGTGCAAAAGACCACGAGAGTGTCAGTCCAAGTACCTGCCTGCCTGCCTGCCTGCCTGCCTGCCTGCCTG CCTGCCTGCCTGCCTGCCTGTATGTATGTATGTATGTATGCATATCTATTCTATGTATATGTAGATAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824474: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244743392712AI069737TENU2781T. cruzi epimastigote normalized cDNA Library


Date: 9:44:58 on Fri 24 Nov 117.