EST 1824476 is a singleton


Sequence

>1824476 (1 EST) Length=422 AGCCGGTTGAGCGTAACACTGTGGGCGATGTCAAATTGGCCGTACGCCACGCACGAGACGCACAGAAGGTGTGGGTGTCC CTCTCTTTTGCAGAGCGGGCAAAACGCGTGGAAAAAGTGAAGCGTTTCTTGGCCGATAACGCGGAACGTGGCGCAACATC ATCTCACAATGTAACGGTAAGACTCGTTGTGATGCGTTGGCGACGGAGATCCTGCCAAGTGTGATGGCCTGTGAGTGGTA TGCGGCGAACACCGCCCGTGTTCTTGCGCCACAGAAATTGTCTCGTGGAAATATGCTTTTTTTCAACAAGTCGAATACCC TCCAATATATTCCTCTTGGCGTTGTTGGCATTATTTCGCCGTGGGAACTTTCCATTTACAATTCCATTTAGCGAGGTGAT TATGGCGCTGATGGCAGGCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824476: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244763392714AI069739TENU2784T. cruzi epimastigote normalized cDNA Library


Date: 14:9:13 on Fri 17 Nov 117.