EST 1824479 is a singleton


Sequence

>1824479 (1 EST) Length=546 TGGAGGAATAAACTTTATGTGTTGGTGAATTGGGTGGGGAGTGCTGTCTTTGGCCGTGACACCACCTTCATTGGCGATCT CAGCGAGGATCGTGTCTGGCGCACGTTAGCGGCGGAGGAGGTTTCACGCGAATATGCCCGGAAAAAGGCCTTTGCCAAGC TAAAGATGATGGAGACAAAAACAACAATCACCGCTGAGACCCTCGAAAAGGGGGCGGAGATGGGCTACATTGCCCGTCAG AGCAACAATGCGGAGGATTCTTCGACTGCGGAAGCAAAAGACACTCCCAACACGAAGCCACAGTGAGACACGACCGCTCT TTGAAATTTCTTGGAATTCACATCCCTTTTATCTGTGTTATTTACAACGCGTGGCCCAATTTATTTATTTTTTTTTCTTT GGCGCTGTTTGCTTTGCGGTTTTTGATAATGAACCGTCCGGGCGGAGGGGCAAAAAGGGGAAATAAGACTACAAGGGACA TCTCTGTTTCTCTGCCTCTGTGTGCGTGTATACATGTGGAATTGATGTTTGTACAGGCACACACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824479: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244793392717AI069742TENU2787T. cruzi epimastigote normalized cDNA Library


Date: 18:47:5 on Thu 23 Nov 117.