EST 1824491 is a singleton


Sequence

>1824491 (1 EST) Length=550 GCCAGCCGGTGGAAGGGGCGATGTACGCGTTTCCGACGATTGAGCTGCCGGAGAAGTACTTTCAGCACAATGAGGAGCTG AACGCGAAGGAGGGGCGAAACTTGGGCCCGACACGCGATGGGCGTTGGAGCTTCTGGAGAGCAGCGGGGTTGTTGTTGTG GCCGGCTCTGGGTTTGGTCAGCAGCCCAACACGCTGCACTTCCGCACGACGATCCTGCCGCCGGAGCAGCAGATGGAACG GATGGTGAAGGCGATGCGCACATTCCAGGAGGGCATTTGGGCAAAGTACGGGTAACGTGGAGAGCGCCTGTGTAAGTACA TACATATATATGTGCATGCATGCATATGTATATATGGGGAAGGGAAGAAGGAAAGGGGAGATGGGGTTTGTCTTTGTTTG TCTGTATTTCCTGATGCAGCACGCATGCCGCCTGCCCACACTGCAGAGATCCGGCATTGAAGCGAATGTCAGTGATGAAT GTGGGTGTGGGGATGGGGAGTGTGTGATTGAGCGAATGATGATTTAGGCAAGTTCTTGCTTTTTGAGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824491: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244913392729AI069754TENU2799T. cruzi epimastigote normalized cDNA Library


Date: 9:10:54 on Sat 18 Nov 117.