EST 1824493 is a singleton


Sequence

>1824493 (1 EST) Length=466 TGAGAAGTCACAAACCAGCCAGTCTCAGCAGGGAGGAAATGAAGGAAAGGACAAGGGGAAAAAAGTCAATTCTGAACCCA CTTCAAACGGAGTAGAGAAGAGCGACATGGGGGATGTCCCGGTGACGATCATGCTGGGCAACAACATGTCAATGCACGTG CGAACAATCATTGCAGCGGACGCGGTTTCGTCAACGTGAAACATCCAATGATGGAGCAACTGGTGCAACGGTCATTCCTG AAAATATTCTGTACAGTGAAAAAAAGGCGGATGATCTTCTCGCGGAACCACCAGAGGTGAAACACAGCGCAAGGCTACAA AGACAATGATGATAGCGCTGAAAAAGGCGCAGGAGGCTTTGGAGAGTGTGCGTGAATTTACGTTATAAATGGAGAATCAA GCATTGCCAGTATCTTTCCTCCAATTCCCCCTCCTATAAAAATACCGTGTTTTATTGCATGCATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824493: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244933392731AI069756TENU2801T. cruzi epimastigote normalized cDNA Library


Date: 9:38:14 on Fri 24 Nov 117.