EST 1824495 is a singleton


Sequence

>1824495 (1 EST) Length=302 TTGAGAATGGCGGCGTACGCGTGCGGTTTGCAAGCGGCATGCAGCAGGATTACCTTGGCGTCATCTGCACGAGCCGCAGC CAAGAGCTTGTGCCGGAGCTCACGTTCACGAGTGAGGAGTTGCAGCAGCGGGCGGAAAATGCGGAGAAATTCAGGGAGAG CCTTGCGAAGGCGGTGCGGTGGATGGAGTTGTGTGTACCTCCGCTGCCGGAGCTGGGGAGGTTTGAAAAGCGCTTCACGC CGGGGTCGCAGGAAATCGTTGAGCTGCTCACCCCGCGCGATGCCAAAATGACAGTGCGACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824495: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244953392733AI069758TENU2803T. cruzi epimastigote normalized cDNA Library


Date: 16:5:56 on Fri 17 Nov 117.