EST 1824499 is a singleton


Sequence

>1824499 (1 EST) Length=425 GAAGCTGCCGCTTTGCTGAAGGACGAGGGAAAAGCAGCCATGGTGTTTGCCGCCTTTGAGAGTCTTGGGGCAGTGAAGAC ATCGCGCACGTTTTTGCTTCTACTTCTCTCCATGCCTGACGCGGCGAGTTCAACGGCACGAATACCAGAAGTTTTGGCGG AGATGTCTGATTTAGGAATTGAGGTTTCAAGTGATTTTCTTCGTGGGGCACTTGAGCTGGCAATTGACGCACAGGATGGT TTTACCGCGATGCAGATGGTTGGGTACCATGAGAAAAGGTCCATCTCCATCGAAAGCAAACTGTCCATACGTCTTATGCG TTTGCTCTGTCTCGTTGTTGATGTTGACAGTGTCCGGCGACTCATCGCTGCGTTGAAGGCGACCGAATCACCCGTTGACT CTCGAACTGTTTCATTGTGTGTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824499: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244993392737AI069762TENU2807T. cruzi epimastigote normalized cDNA Library


Date: 9:21:11 on Sun 19 Nov 117.