EST 1824503 is a singleton


Sequence

>1824503 (1 EST) Length=516 ACGCAGGGGTGGAGTTTTCTTGACGTTTTCAGCAAGATGCTGCCGCACCCGGAAGAGGACGAAGCCTTTGACGAGGCGGA TGACGACGAGCTTGCCGACGCCGTGGAGAACTGGGAGTCCGAGATGGAGGACCGTCGGGATTTACTCTTGACGTTAGTTG AGGACGTTTGGCTTGACCCCATCGCCGCACTCATGAGAAAGCGGGCGGAGGAGCGGGATGGCAGCAGTGGGCCGAGGTTA AAAAGGATGAAGACGGAGTAAAATTGCCGTGATGCTGAACCCCAGCTATGGACACGGACTCTGACTTGTTGTACCGATAA TACAGAAGCAAAGCAAAAAAAAAAAAAAAAAGAAAAGAGAACGAGGAGATTATGTGGTTGGGCAATGAAGTGGGATTGCG GTGCCATTTTTTTTGTTGTTGTTGTTTTAAGACTTTTTTTTCTCTTTTGCATTATTCTTTTTCAATAGCCTTGGATGTGG AGGCAATGGTGCATCTGTTCGTGTGGGCGTTTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824503: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245033392741AI069766TENU2811T. cruzi epimastigote normalized cDNA Library


Date: 19:14:52 on Wed 22 Nov 117.