EST 1824523 is a singleton


Sequence

>1824523 (1 EST) Length=259 ACACTCACGATGATGATGACGTGCCGTCTGCTGTGCGCCCTGTTGTTGCTTGCCCTGTGCTGCTGCCCGTCCGTTTGCGC GTCACGAACCGGAGCATAAAGTTGATGTTCAAGCTTCCCAGACGACCACGACGAATACAACACAGCCACCAACTACTAAT GACAAGGCTAATACTCAAGCTGTTGGAAAAGGCGCCGGTCAATCGTCTCCACAACCAGAGCCATCACACCCGGCCGCCGG TGAGCCAGGATCGTCCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1824523: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245233392761AI069786TENU2857T. cruzi epimastigote normalized cDNA Library


Date: 15:5:40 on Wed 22 Nov 117.