EST 1824525 is a singleton


Sequence

>1824525 (1 EST) Length=310 CCGACCTTCTGGCCCCGTTTCTCCGGCGGATGAGTTGGTGCTACGCAGTGGGGAAGCAATCTGACAAAGAGAGGGTGGCA GCGGCAGAGGCAGCGGGGACTTTGTCGGGGGGAATGACCCCGCCATCCCATGAAGCCATTGGTGCGGCTCTGGAGGATCT TTTATTGGCTTCTATTGCCACGTTTCCCCACAGTGCGGTGTTGTTCTACCTGCTGGCATCTATGCGTGCGATACAAGGAC GCCAGGAGGAGTCACTCCATCTTTTGGAGGAAGTCATACGTCTCGACCCCTCACACTTGCTACGCGAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824525: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245253392763AI069788TENU2859T. cruzi epimastigote normalized cDNA Library


Date: 20:46:0 on Wed 22 Nov 117.