EST 1824526 is a singleton


Sequence

>1824526 (1 EST) Length=330 TTACTTCAAATGATTCGGAATTACATCAATGGAGGACCTCTTGTGGGAAAATTAGACCGTGCGGACTTCGATGGGCAGTA AGTGTCTGTCTGTCGCATTCCACACCGCTTGTGATTGCCTCTACAAGATCCATTGGGATGATACCTATTGTTCATCTGTT TCCACATGGTGGGAAAGAAACGAATTCCTTTCTTGTTGCCCGTACGAGCCGGCCGAATTCAACGGAGAGAATTGCAGCGT TTTTTAGCAGACACCATGGCTATGACTTTATGCGTGACAGAGAAGGGAAATGGATCTTTCTTGTCCCGTCCCGCCCCCTG CAGTCTGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824526: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245263392764AI069789TENU2860T. cruzi epimastigote normalized cDNA Library


Date: 22:22:26 on Thu 23 Nov 117.