EST 1824527 is a singleton


Sequence

>1824527 (1 EST) Length=496 GCGTAAGATGGCATCCACGCTGGAACACATGAAGAAGGTGCGAGCCGCCCGGAAGGAGCGCTCTTCGAAGACGAAGGGCG ATCGCATTCTTGTACATCGACTTGGGCTTGTTGCCCGCCTTGCCGTCCTTCGTCGTCACAAGAATGCGATCGCCCTTCGT CTTCACCACGGCAGCCTTCGTGTTCAAAAAGCCGGCGTGGAGGCCTCTGTTGTGAGCAAGGCCGTCGCTGCTGTCCGCCC TGACCTGGCAAGCGTAGATCCCGCCGCGCGCGTAAGATGGCATCCACGCTGGAACACATGAAGAAGGTGCGAGCCGCCCG GAAGGAGCGCTCTTCGAAGATCACGTTCCAGCGCAAGGCCGTTCGCCCCAAGCGCCACTGAGAGGCACCTGACAGCTGGA GCCTGGGCGACCGTCTCCTAGCGTGATGCAACACGCACGCAGACTTCATTTCGTTTTATTTTTATATTTCTTTCATAAAT ACATATATTGTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1824527: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245273392765AI069790TENU2861T. cruzi epimastigote normalized cDNA Library


Date: 20:49:12 on Thu 23 Nov 117.