EST 1824528 is a singleton


Sequence

>1824528 (1 EST) Length=501 CGAGAAGATGAAAATACAGGCCCATTCAAAACGTCAATCCTCCTCTCCCCCGACTGAAAAACTAAAAACCAGCCTTCCAC CTCTTGAGTGCGAAAAAGCCACAACGACTGTGTCCTCTTCCAGGTTTTTGGGAATGCAGGATAACGCGATTCGTGACAGA CGAACGGCATTTGAGGCATATAAGCGCACAAGCGGGGGAGCTTGCCAGTTGGAGGCCATAGAGAATGCTCGAAAACTTGT AGCAGAGAAGAAAGAAAACATATTGCAGCTCCAAAAACGAGTGAAAGAGATTAGGTTAAGCATGGAGGAAAGTAAGAAGT CTGAAGGGTCTCAAACCCCCGTCATGGAAGAAAATGCGATTGCAAGGCATGCGTCCGTAGATGCGACACACTCATCCTAC GCGTTATTTGAAGGAAGTCACAGCGCGACTGAGAATAATGTGAATTTTTCCGAGTATTTTTCTACGTCACCCGTGGAAAA CCTCCCTCACATGACGTTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824528: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245283392766AI069791TENU2862T. cruzi epimastigote normalized cDNA Library


Date: 2:9:20 on Wed 22 Nov 117.