EST 1824534 is a singleton


Sequence

>1824534 (1 EST) Length=352 TACCTTTAAGAATCTTCAAGCTGTATTTATCTGAATCTGGATGAAAGCAAAAAAAAAAAAAACATGACACCATAATAAAT CTGTTTTCCTTATTTTAGCTCCTGTAGGCACCGTAGTCCGTATTCTCGAACTGGCAGGTCGGTTGTCCTTTTTAAAACAT GCTGGATGAGGTCCGCGTCTTTTTCACGGAAGGCATCATCAATAGCCAGTCGCGGCTGCTGCAAGTGCATGAGCCAGTCT ACTCGTCTAGTGACATCATCTAATTTTGGTATGAGAAGCAATGCGCTTTCCACCCGCGAGTGGAGAACGAACTGCTCAAC AAATGGCTGGTAACCGATGGACGGTCTGGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824534: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245343392772AI069797TENU2869T. cruzi epimastigote normalized cDNA Library


Date: 12:45:17 on Fri 17 Nov 117.