EST 1824539 is a singleton


Sequence

>1824539 (1 EST) Length=400 TGAATGGCGTGAGTCGTGACTGTTTCTGCTCGTACGTGAGGAAATCAAACGTACACGCGTTCGGCGGTCACTACAGCAGC AGAGGTGGTGCGGGCCTTGCGGCGGGGGACTAGCATGAGGGGCTCGAGGTCCAAAGAGCATGGAAACGGAGAAGAAAAAA GGCCGGTCAAATTGGAATGAGGAGGGAAAATAAAAAAAATAGAGGAGAGGACGAGGGGCTTCGCGGACACGCGTCGTTGC GATGGAGATAAATTTGGTCCGGGCATCCCGATCCAGCCTGCTACTGTGGTGGGAGCCAGATGAATTCTATTCGTCTGATT TTGCGCCCCTTTTTTTTTTGTTTTTTTTTTTGATTCAGGTGACAATTACCGTTGGCCGTTGCAATTCCGCTGTACTTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824539: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245393392777AI069802TENU2874T. cruzi epimastigote normalized cDNA Library


Date: 1:29:29 on Sun 19 Nov 117.