EST 1824542 is a singleton


Sequence

>1824542 (1 EST) Length=546 CGATTTGAAGGATGACATTGGCCCACCAATTTTGGAGCGCACCGCCACTTTTTCCCCGAACGGGAATATTTCCAGTAGAG AAGCACAGGACTTAAATAGCAGGACGATGTGGTCCTCCGTCATTCCATGCGCATCATCGGAATTGGCTCAACCGGACCCA TGTGACACCGCCGCAACGATAAAAAAGAGTTTTACTCCTCCACCGCGTCCTACTCGATCGGCGTCATCTAACGATGTTGT GGGATCAGGTGACAGAGCATCGTATGCCCGGCGTTATTTGCAACGGCTGTACTTCCGTGATCCTGTCGTCGTTCGACCCG CCAACGGTCCGCCGCAACCTGCCCCCGGCGTGCGAAGGAAAGAAACGAAGTCCGTCTTTGAGCGGTGTTTTTATGATTTT ACAAAACACATATTTACTCCGCCGCACACGTCCGGCTTGGCGGCTGTAAGTCATTTGAAAAATGAACGACGACTGAACGC GTTGTCTAGCTTGGGCATGACTGGTGCGCGACAAGGCAGCTCCCGCACGAGTAGTTGTAGTGCGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824542: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245423392780AI069805TENU2877T. cruzi epimastigote normalized cDNA Library


Date: 11:58:9 on Fri 24 Nov 117.