EST 1824543 is a singleton


Sequence

>1824543 (1 EST) Length=300 GCTGCCATCCCAGCAGAATGATATCCCCGTCTTCTTCTTATATTCGGCGCAGTCGCGGCGATGATCCCTTTTACACATCT TCCTGGTACACCAGCGTGACTCATGGCTCCCCGAGGACGCGAGATTCCGCAACGGCACGGAGCGTCCAGAGGCCTGTCTT TGGGTTTATGGTCTCTGCTTTTGGTCAAAAGCTGGAGGAGCATCTGCGGAATGCGAGCACCCCTGAACACGTTGTGCAAC CCCGTGTGGGATTGAAAAGTAGTGGACAATTGAAAGCAAGCAAATTTTTGACAGTTTCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824543: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245433392781AI069806TENU2878T. cruzi epimastigote normalized cDNA Library


Date: 20:10:5 on Sat 18 Nov 117.