EST 1824549 is a singleton


Sequence

>1824549 (1 EST) Length=249 GAACAAAACAACAACAACAAAAGCAAGAAGGGATCTTAATTGGTTCCGAATTTTATTTATTTTTTTTTTTTTTTTATTAT TTCTTGCTGGAAGCAACAAGCAGAATTTCAAAAGGGAAGCTGAAACGAAAGCGAGAAAATGGCGTTTACTCTTCAAAATG AACTTACTTTTTTCCATTTTCTCCTCTCTTTTATCGTTGGAACGATGACTTTCATGTTCTTCCTTTTTTTCCTGCGCAAG AGGCAGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824549: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245493392787AI069812TENU2884T. cruzi epimastigote normalized cDNA Library


Date: 23:26:39 on Fri 17 Nov 117.