EST 1824553 is a singleton


Sequence

>1824553 (1 EST) Length=204 GCGTTGGATCCTCATCATCGTTTGTGTCATGCACCTTGAGCCATCAATGCGAACGAGAAGAAGCAGAATTACTGTTCCAT GGAGTGCGATTTCTTTGGCTGCCCTTGCACTTCATGGAGAACGAGCTCCGGCGTTGCGAGGGCTTGGGAATGACGGCAGA GGCGTGTCACTGTACGATCTACGCAGGGCTAATTCTGCTCTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824553: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245533392791AI069816TENU2888T. cruzi epimastigote normalized cDNA Library


Date: 16:9:47 on Fri 17 Nov 117.