EST 1824557 is a singleton


Sequence

>1824557 (1 EST) Length=406 GCAGTGTCGGGAGATGGAGTTACTCAAGAGTCAACTACTGGAGAGTGAACAAAAAAGCAACGTCCTTGAGCAATTACTGA AGGGCGTCAAGACGCAACATCCTCCTTTTCAAGACGTGTTTGCTCGCACACGGCGTCATATCGATGAACAGCAAGAGATG GTACGTAAGACGTACGAGGGTCGCATACAGGCGTTACAGCAGCAACTAGCACAGGAGCGTGAACAACGCTTGCGGCTCAT GAATGAAGTAGATGTGTTGTCTATGGAGTCGAGAAAGGCGCTGGAGCCGTGCACCAATGCGGCCCAGCGGGTGGAGATGA ACAATGTGTGCATGGCACTGCAGCAGTTAGAGGAGCGTATTCGCACTGAAACGAAAAATGGTATCGAGGCGGCGGTACTA GCACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824557: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245573392795AI069820TENU2892T. cruzi epimastigote normalized cDNA Library


Date: 12:8:42 on Fri 17 Nov 117.