EST 1824560 is a singleton


Sequence

>1824560 (1 EST) Length=291 GGAAGGAGCAAAACATCAAAACTGTTCCTGTGGTCACACTAAACAAATACAATGAAACAAAATGGGCCCACGCTCTTCCA AATTTCCAGGTCCATTCTCAGGGGGAACTACGAGACATCTCATTTTCAAAACCACGGCAAATATTTAGTTCGTTTTTCTT CGCACTTTCCCCGCTCACTCTGTCGCCGCCACAACCATTCGGCACCCTCTTCTCCATCCCCCCTGAAACACGCAGTGCAA CACCGCACACATGACAGTGAGGAAGACGGAGAGAGGATGGAGGGAGAACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1824560: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245603392798AI069823TENU2895T. cruzi epimastigote normalized cDNA Library


Date: 16:25:16 on Sun 19 Nov 117.