EST 1824566 is a singleton


Sequence

>1824566 (1 EST) Length=360 CTGCTGCCTGACCGCATCCGTTATGCTTCTGTGAAGGAGCGTGAAAAGACGTTTTCGAAGCATTACGGGCACTTCTGCGC GTATTACAAAAGCAGTTGTTTTACATCTGTTATGTTGACACGCCTGGCGATCAGCACGGTGGGATATTTTGACGAGAACT TCTACCCAGCTTACGTGGAGGATGTCGACTACAGCTTACGCCTCCGTTTGCTTGGATTTCAGGAGCGAAATGTCTTCTAC GGCAAATTTGTGCATCGCAGCAACTATAATATTCGTTTCTCTAATAAAATGGAGCTACCGGACGCTCTCTGGTACCGTCG CGTCAGGTCTTTGAGTGCGAACAAACCATATGTCGTGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824566: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245663392804AI069829TENU2901T. cruzi epimastigote normalized cDNA Library


Date: 19:14:56 on Thu 23 Nov 117.