EST 1824574 is a singleton


Sequence

>1824574 (1 EST) Length=316 CGTCCGCCGCGTGTATTGTGTTGGGCAGAACTACGCGGACCACGCGAAGGAAATGGGTGGGCAGGTTTCCAAGTCCAATC CATTTTTCTTCACAAAGCCCCCTGATGCGGTTGTCAGTGGTGAGACGAACCATACGGCGGCAATGGATGTCAACATCCGT TATCCTCCTCAGACCAACAACTACCAGTACGAGGTGGAGCTGGTTGTTGCCATTGGCGAAACAAGGTGGCAGGGAGAAGT ACAGGGCCATTTCTCCTCTAGAAGCACACACAGTCATCTACGGCTACGCCGTGGGTCTTGACATGACACGACGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824574: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245743392812AI069837TENU2910T. cruzi epimastigote normalized cDNA Library


Date: 14:25:15 on Fri 17 Nov 117.