EST 1824582 is a singleton


Sequence

>1824582 (1 EST) Length=368 GAACATTTGGTTGGAACACCTGCGAGGTCTCCTGAAGGCTATTGTGGAGGAAACCCTAGCAGCAAGGTCCGTCAAGCGCT ACGAGGACGATGAGGTTGTGCAGGACACGGGATATTCCTCTGCGAAGGCCTTTGGAAAGGAAAATTTAGCCGACGTTTCT AAGATGTTGCATGCCATTTATAACATTCAGAAAGATCGCTTCACCACCTTGCACCCGACGACAGCACGAGCAGAGTTTGT GCTTGGCCTATTTCTTCTTTGGGTAAGTAAAACCNGGGAGGCGGCGCATCATCTGCAAACGGCACGGGCGACGTCGCAAC ATTTCTACGGTGAGCGGCATCCAGTAGTACAGGAAATAGAAGAGTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18245823392820AI069845TENU2821T. cruzi epimastigote normalized cDNA Library


Date: 16:37:29 on Sat 18 Nov 117.